pet-22b(+) vector Search Results


90
Merck & Co pet-22b
Pet 22b, supplied by Merck & Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pet-22b/product/Merck & Co
Average 90 stars, based on 1 article reviews
pet-22b - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Merck & Co pet22b vector
Pet22b Vector, supplied by Merck & Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pet22b vector/product/Merck & Co
Average 90 stars, based on 1 article reviews
pet22b vector - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Sloning BioTechnology codon-optimized gene versions
Codon Optimized Gene Versions, supplied by Sloning BioTechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/codon-optimized gene versions/product/Sloning BioTechnology
Average 90 stars, based on 1 article reviews
codon-optimized gene versions - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Novartis pet22b expression vector
Pet22b Expression Vector, supplied by Novartis, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pet22b expression vector/product/Novartis
Average 90 stars, based on 1 article reviews
pet22b expression vector - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Qiagen pet-22b (qiagen, hilden, german)
Expression of SA and SB proteins in E. coli .
Pet 22b (Qiagen, Hilden, German), supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pet-22b (qiagen, hilden, german)/product/Qiagen
Average 90 stars, based on 1 article reviews
pet-22b (qiagen, hilden, german) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
tiangen biotech co plasmid pet22b-rtcs
Expression of SA and SB proteins in E. coli .
Plasmid Pet22b Rtcs, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid pet22b-rtcs/product/tiangen biotech co
Average 90 stars, based on 1 article reviews
plasmid pet22b-rtcs - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


Expression of SA and SB proteins in E. coli .

Journal: Vaccines

Article Title: SARS-CoV-2 Spike Protein-Expressing Enterococcus for Oral Vaccination: Immunogenicity and Protection

doi: 10.3390/vaccines11111714

Figure Lengend Snippet: Expression of SA and SB proteins in E. coli .

Article Snippet: SB , pET-22b (Qiagen, Hilden, German) , E. coli BL21 , CS1 , F , TTGCATATGGATTATTCTGTCCTATATA , Cloning a gene fragment for protein SB production.

Techniques: Expressing, Recombinant, Plasmid Preparation, Sequencing, Cloning